Sequence ID | >WENV170643909 |
Genome ID | JMBV01007789 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 730 |
End posion on genome | 803 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
gcataatcta |
tRNA gene sequence |
GGATGATTAGCTCAGCTGGTTAGAGCACTACATTCACATTGTAGGGGTCATTGGTTCGAA |
Downstream region at tRNA end position |
tccttttttt |
Secondary structure (Cloverleaf model) | >WENV170643909 Val CAC a Attt tccttttttt G - C G - C A - T T - A G - C A - T T - A T A T T A A C C A C G A A | | | | | G T C T C G A T T G G C G | | | | T T G G A G C T T A A GGGTC C - G T - A A - T C - G A - T T T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |