Sequence ID | >WENV170643931 |
Genome ID | JMBV01011289 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 188 |
End posion on genome | 261 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cggatatgct |
tRNA gene sequence |
GGGGGTGTAGCCAAGCGGTAAGGCACGGGATTTTGGATCCCGCATGCGTAGGTTCGAATC |
Downstream region at tRNA end position |
ccattttttt |
Secondary structure (Cloverleaf model) | >WENV170643931 Gln TTG t CCAg ccattttttt G - C G - C G - C G - C G - C T T G - C T A T C A T C C A G A A | | | | | G C A C C G G T A G G C G | | | T T G A G G C T A A CATGC C - G G - C G - C G - C A - T T A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |