Sequence ID | >WENV170643937 |
Genome ID | JMBV01011961 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 70 |
End posion on genome | 147 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tcatatacgt |
tRNA gene sequence |
GACCCTATGGTCAAGCGGTGAAGACACCGCCCTTTCAAGGCGGTAACGGGGGGGGTTCGA |
Downstream region at tRNA end position |
atttttaggg |
Secondary structure (Cloverleaf model) | >WENV170643937 Glu TTC t ACCA atttttaggg G - C A - T C - G C - G C - G T - A A - T T A T C C C C C A C G A G | | | | | G G A C T G G G G G G C G | | | T T T A G A C G A A TAACGGG C - G C - G G - C C - G C - G C A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |