Sequence ID | >WENV170643939 |
Genome ID | JMBV01012251 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 483 |
End posion on genome | 558 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
agaagaatgt |
tRNA gene sequence |
GGGGACGTAGCTCAGTTGGGAGAGCGCGTGAATGGCATTCATGAGGTCGTGGGTTCGAAT |
Downstream region at tRNA end position |
ttttttttat |
Secondary structure (Cloverleaf model) | >WENV170643939 Ala GGC t ACCA ttttttttat G - C G - C G + T G - C A - T C - G G - C T A T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C G A G AGGTC C - G G + T T - A G - C A - T A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |