Sequence ID | >WENV170643941 |
Genome ID | JMBV01012426 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 274 |
End posion on genome | 350 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ctccattttT |
tRNA gene sequence |
GAGCCATTAGCTCAGTCGGTAGAGCATTTGACTTTTAATCAAAGGGTCGCAGGTTCGATT |
Downstream region at tRNA end position |
agaattttgc |
Secondary structure (Cloverleaf model) | >WENV170643941 Lys TTT T ATCA agaattttgc G - C A - T G - C C - G C - G A - T T - A T T T C G T C C A T G A A | | | | | G C C T C G G C A G G C G | | | | T T G G A G C T A A GGGTC T - A T - A T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |