Sequence ID | >WENV170643948 |
Genome ID | JMBV01012795 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 468 |
End posion on genome | 551 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ttactactaa |
tRNA gene sequence |
GCAGGAATGGCGGAATAGGCAGACGCGCGGGACTTAAAATCCCGTTCTAGCAATAGAGTG |
Downstream region at tRNA end position |
cactattaat |
Secondary structure (Cloverleaf model) | >WENV170643948 Leu TAA a Attt cactattaat G - C C - G A - T G - C G - C A - T A - T T T T C T C T C A T A A G | | | | | G A G G C G G A G A G C G | | | T T G A C G C C A G G TTCTAGCAATAGAGT C - G G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |