Sequence ID | >WENV170643952 |
Genome ID | JMBV01013252 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 139 |
End posion on genome | 61 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
atcgtaacgc |
tRNA gene sequence |
GCGCCCGTAGCTCAGTGGATAGAGCGTCTGACTTCGGATCAGAAAGCCGGGGGGGGTTCA |
Downstream region at tRNA end position |
tagtttagct |
Secondary structure (Cloverleaf model) | >WENV170643952 Arg TCG c GCCA tagtttagct G - C C - G G - C C - G C - G C - G G - C T A T C T C C C A T G A A | + | | | A G C T C G G G G G G C G | | | | T T A G A G C T A G AAGCCGGG T - A C - G T - A G - C A - T C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |