Sequence ID | >WENV170643953 |
Genome ID | JMBV01013256 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 379 |
End posion on genome | 451 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gaagtgccac |
tRNA gene sequence |
GTCTCCGTGGCCTAATGGATAAGGCACTGGCCTCCGGAGCCAGCAATCTGGGTTCGAGTC |
Downstream region at tRNA end position |
tagtcaaaac |
Secondary structure (Cloverleaf model) | >WENV170643953 Arg CCG c ACtt tagtcaaaac G + T T - A C - G T - A C - G C - G G - C T G T G A C C C A T A A G | | | | | G G T C C G C T G G G C G | | | | T T A A G G C T A A CAAT C - G T - A G - C G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |