Sequence ID | >WENV170643956 |
Genome ID | JMBV01013683 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 385 |
End posion on genome | 312 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tgcacggctG |
tRNA gene sequence |
CCCCCTATAGCTCAGTAGGTAGAGCGCATTCTTGGTAAGAATGAGGTCATCGGTTCGACT |
Downstream region at tRNA end position |
gccgaataat |
Secondary structure (Cloverleaf model) | >WENV170643956 Thr GGT G Tttt gccgaataat C C C - G C - G C - G C - G T + G A - T T C T T A G C C A T G A A | | | | | G A C T C G A T C G G C G | | | | T T G G A G C T A G AGGTC C - G A - T T - A T - A C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |