Sequence ID | >WENV170643957 |
Genome ID | JMBV01014090 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 43 |
End posion on genome | 126 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aatataaatt |
tRNA gene sequence |
GCAGGAGTGGTGGAATTGGCAGACACGTACGTTTGAGGGGCGTATGGCATAGCCATGAGG |
Downstream region at tRNA end position |
atagcaaatt |
Secondary structure (Cloverleaf model) | >WENV170643957 Leu GAG t ACCA atagcaaatt G - C C - G A - T G - C G - C A - T G - C T G T T T C C C A T A A G + | | | | G T G G T G G A G G G C G | | | T T G A C A C C A G G TGGCATAGCCAT T - A A - T C - G G - C T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |