Sequence ID | >WENV170643969 |
Genome ID | JMBV01015076 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 554 |
End posion on genome | 480 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gtatttaaat |
tRNA gene sequence |
AGGGCTATAGCCAAGCGGTAAGGCAACGGACTTTGACTCCGTCATTCGATTGTTCGAATC |
Downstream region at tRNA end position |
ttttcaacat |
Secondary structure (Cloverleaf model) | >WENV170643969 Gln TTG t GCCA ttttcaacat A - T G - C G - C G - C C - G T - A A - T T A T C T A A C A G A A | | | | | G C A C C G G A T T G C G | | | T T G A G G C T A A CATTC A - T C - G G - C G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |