Sequence ID | >WENV170643982 |
Genome ID | JMBV01016610 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 229 |
End posion on genome | 154 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
aatttaaaaa |
tRNA gene sequence |
GGGCGCATAGCTCAGTTGGGAGAGCACCTGCCTTACAAGCAGGGGGTCATAGGTTCAAGC |
Downstream region at tRNA end position |
tttggataat |
Secondary structure (Cloverleaf model) | >WENV170643982 Val TAC a ACCA tttggataat G - C G - C G - C C - G G + T C - G A - T C G T T A T C C A T G A A | | | | | A T C T C G A T A G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |