Sequence ID | >WENV170643986 |
Genome ID | JMBV01017794 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 255 |
End posion on genome | 180 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gagaaatagt |
tRNA gene sequence |
GCTGAATTAGCTCAGTTGGTAGAGCACATTCTTGGTAAGAATGAGGTCCCGAGTTCGATC |
Downstream region at tRNA end position |
tatctcttta |
Secondary structure (Cloverleaf model) | >WENV170643986 Thr GGT t TCCA tatctcttta G - C C - G T - A G - C A - T A - T T - A C T T G G C T C A T G A A | | | | | G T C T C G C C G A G C G | | | | T T G G A G C T A A AGGTC C - G A - T T - A T - A C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |