Sequence ID | >WENV170643998 |
Genome ID | JMBV01019968 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 297 |
End posion on genome | 209 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gtttactgat |
tRNA gene sequence |
GGAGGGGGTGTCCGAGCGGTTTAAGGAGCTGGTCTTGAAAACCAGTGACTCGAAGAGCCG |
Downstream region at tRNA end position |
gattaaacta |
Secondary structure (Cloverleaf model) | >WENV170643998 Ser TGA t GCCA gattaaacta G - C G - C A - T G - C G - C G - C G - C C C G C C C A C T C G A G T | | | | A G C C T G G G G T T A G | + C G T A G G A T T A G TGACTCGAAGAGCCGT C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |