Sequence ID | >WENV170644001 |
Genome ID | JMBV01020003 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 330 |
End posion on genome | 415 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
taataaatta |
tRNA gene sequence |
GGAGGAGTGCCCGAGTTGGCTAAAGGGGACGGACTGTAAATCCGTTGGCTAAGCCTTCAC |
Downstream region at tRNA end position |
aaatcaaatt |
Secondary structure (Cloverleaf model) | >WENV170644001 Tyr GTA a ACCA aaatcaaatt G - C G - C A - T G - C G - C A - T G - C T A T T G A C C A T T G A G | | | | | G G G C C C A C T G G C G | | | T T C A G G G T A A G TGGCTAAGCCTTC A - T C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |