Sequence ID | >WENV170644002 |
Genome ID | JMBV01020554 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 78 |
End posion on genome | 3 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gcgatagagt |
tRNA gene sequence |
GCGCCCGTAGCTCAGTGGATAGAGTGACGGACTACGAATCCGCAGGCCGCAGGTTCGAAT |
Downstream region at tRNA end position |
ttnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170644002 Arg ACG t GCCA ttnnnnnnnn G - C C - G G - C C - G C - G C - G G - C T A T C G T C C A T G A A | | | | | G G C T C G G C A G G C G | | | + T T A G A G T T A G AGGCC A C C - G G - C G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |