Sequence ID | >WENV170644004 |
Genome ID | JMBV01020763 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 190 |
End posion on genome | 263 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ccattatcgC |
tRNA gene sequence |
GGGGGGGTGGAGCAGCTGGTAGCTCGTCGGGCTCATAACCCGGAGGTCGTAGGTTCAAAT |
Downstream region at tRNA end position |
attacaactg |
Secondary structure (Cloverleaf model) | >WENV170644004 Met CAT C Attt attacaactg G A G - C G G G - C G - C G - C G - C T A T C A T C C A C G A G | | | | | A T C G A G G T A G G C G | | | | T T G G C T C T A G AGGTC T + G C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |