Sequence ID | >WENV170644006 |
Genome ID | JMBV01020970 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 362 |
End posion on genome | 286 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gaacatagat |
tRNA gene sequence |
GCGCACTTAGCTCAGCGGGAGAGCACCTCCTTGACGCGGAGGGGGGGCCAGAGGTTCGAT |
Downstream region at tRNA end position |
tctgcttatt |
Secondary structure (Cloverleaf model) | >WENV170644006 Val GAC t ACCA tctgcttatt G - C C - G G - C C - G A - T C - G T - A C T T T C T C C A G A A | | | | | G C C T C G A G A G G C G | | | | T T G G A G C G A A GGGGGCC C - G C - G T - A C - G C - G T C T G G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |