Sequence ID | >WENV170644010 |
Genome ID | JMBV01021255 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 136 |
End posion on genome | 61 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
acaaatatta |
tRNA gene sequence |
GCCAATATAGCTCACTAGGCAGAGCAGCAGTCTCGTAAACTGCAGGTAAAGGGTTCGAAT |
Downstream region at tRNA end position |
acctagcaaa |
Secondary structure (Cloverleaf model) | >WENV170644010 Thr CGT a TCCA acctagcaaa G - C C - G C - G A - T A - T T - A A - T T A T T T C C C A T C A A | | | | | G A C T C G A A G G G C G | | | | T T G G A G C C A A AGGTA G - C C - G A - T G - C T - A C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |