Sequence ID | >WENV170644012 |
Genome ID | JMBV01021535 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 349 |
End posion on genome | 423 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ttaaaattat |
tRNA gene sequence |
GGCCCTATGGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGGTAACCCGGGTTCGAGTC |
Downstream region at tRNA end position |
caaaatgggc |
Secondary structure (Cloverleaf model) | >WENV170644012 Glu TTC t ACCA caaaatgggc G - C G + T C - G C - G C - G T - A A - T T G T G G C C C A C G A G | | | | | G G A C T G C C G G G C G | | | T T T A G A C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |