Sequence ID | >WENV170644022 |
Genome ID | JMBV01022709 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 102 |
End posion on genome | 176 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tacatcacga |
tRNA gene sequence |
GCGGATGTGGCCTAGCGGTAGGGCAACGGCTTCCCAAGCCGTGGATCGCGGGTTCGAATC |
Downstream region at tRNA end position |
tttatttccc |
Secondary structure (Cloverleaf model) | >WENV170644022 Gly CCC a TCCA tttatttccc G - C C - G G - C G - C A - T T - A G - C T A T T G C C C A G A G + | | | | G C T C C G G C G G G C G + | | | T T G G G G C T A A GGATC A - T C - G G - C G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |