Sequence ID | >WENV170644032 |
Genome ID | JMBV01023533 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 212 |
End posion on genome | 288 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
cataacattt |
tRNA gene sequence |
GGCCTGGTAGTTCAGATGGTTAGAATGCCAGCCTGTCACGCTGGAGGTCGAGGGTTCGAG |
Downstream region at tRNA end position |
cttattcgcc |
Secondary structure (Cloverleaf model) | >WENV170644032 Asp GTC t GCCA cttattcgcc G - C G + T C - G C - G T - A G - C G - C T G T T T C C C A A G A A + | | | | G T C T T G G A G G G C G | | | + T T G G A A T T T A G AGGTC C - G C - G A - T G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |