Sequence ID | >WENV170644041 |
Genome ID | JMBV01026096 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 307 |
End posion on genome | 231 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ccaccgtaat |
tRNA gene sequence |
GTACCTGTAGCTCAACCGGATAGAGCAACTGCCTTCTAAGCAGTAGGTTGTAGGTTCGAT |
Downstream region at tRNA end position |
ctttattgtt |
Secondary structure (Cloverleaf model) | >WENV170644041 Arg TCT t GCCA ctttattgtt G - C T - A A - T C - G C - G T - A G - C T T T C G T C C A C A A A | + | | | G C C T C G G T A G G C G | | | | T T G G A G C A T A A AGGTT A - T C - G T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |