Sequence ID | >WENV170644056 |
Genome ID | JMBV01028824 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 166 |
End posion on genome | 79 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gtttcaaagc |
tRNA gene sequence |
GCGAGGGTTGCCCAGCCAGGTCAAAGGCGCCAGACTTAAGATCTGGTATCGAAGGATTTC |
Downstream region at tRNA end position |
gcttttacat |
Secondary structure (Cloverleaf model) | >WENV170644056 Leu TAA c ACTA gcttttacat G - C C - G G - C A - T G - C G - C G - C T A T T A C C C A C C G A T + | | | | G A C C C G G T G G G C G | | | T T G A G G C T C A A G TATCGAAGGATTTC C - G C - G A - T G - C A - T C A T G T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |