Sequence ID | >WENV170644060 |
Genome ID | JMBV01030159 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 52 |
End posion on genome | 141 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tatcggcatt |
tRNA gene sequence |
GGAGAGATGTCTGAGTGGTCGAAAGAGACGGTCTTGAAAACCGTTGTACAGTCTTCTGTA |
Downstream region at tRNA end position |
taatcgactg |
Secondary structure (Cloverleaf model) | >WENV170644060 Ser TGA t GCCA taatcgactg G - C G - C A - T G - C A - T G - C A - T T A T C A C C C A T G A G | | | | | G G G T C T G T G G G C G | | | T T T A A G A C G A G TGTACAGTCTTCTGTACC A - T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |