Sequence ID | >WENV170644066 |
Genome ID | JMBV01031175 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 111 |
End posion on genome | 185 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gggagccatt |
tRNA gene sequence |
GGGCCCATAGCTCAGCGGTAGAGCGGTCGGCTCATAACCGATTGGTCCCAGGTTCGAATC |
Downstream region at tRNA end position |
aattattaca |
Secondary structure (Cloverleaf model) | >WENV170644066 Met CAT t ACCA aattattaca G - C G - C G - C C - G C - G C - G A - T T A T G G T C C A G A A | | | | | G C C T C G C C A G G C G | | | | T T G G A G C T A G TGGTC G + T T - A C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |