Sequence ID | >WENV170644068 |
Genome ID | JMBV01032084 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 135 |
End posion on genome | 210 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tagttaccgC |
tRNA gene sequence |
GGGGGGGTAGAGCAGTGGAAGCTCGTTAGGCTCATAACCTAAAGGTCGCTGGTTCGAATC |
Downstream region at tRNA end position |
tttttctact |
Secondary structure (Cloverleaf model) | >WENV170644068 Met CAT C ACCA tttttctact G A G - C G G G - C G - C G - C G - C T A T C G A C C A G A A | | | | | G T C G A G G C T G G C G | | | | T T G G C T C A A G AGGTC T - A T - A A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |