Sequence ID | >WENV170644069 |
Genome ID | JMBV01032517 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 65 |
End posion on genome | 140 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ctccatattt |
tRNA gene sequence |
GGGCGGGTGGCGAAGTGGCTAACGCTGTGGTCTGCAAAATCACCATTCACCGGTTCAAAT |
Downstream region at tRNA end position |
tataagcagt |
Secondary structure (Cloverleaf model) | >WENV170644069 Cys GCA t TCCA tataagcagt G - C G - C G - C C - G G - C G - C G - C T A T T G G C C A T G A G | | | | | A G A G C G A C C G G C G | | | T T C A C G C T A T CATTC G - C T - A G - C G + T T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |