Sequence ID | >WENV170644077 |
Genome ID | JMBV01033099 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 177 |
End posion on genome | 255 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ttattttagt |
tRNA gene sequence |
GTGCCCGTAGCTCAGTTGGATAGAGCGGCGGATTCCTAATCCGCGTCTGTCGCAGGTTCG |
Downstream region at tRNA end position |
tttattttga |
Secondary structure (Cloverleaf model) | >WENV170644077 Arg CCT t ACCA tttattttga G - C T + G G + T C - G C - G C - G G - C T A T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A G GTCTGTC G - C C - G G - C G - C A - T T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |