Sequence ID | >WENV170644082 |
Genome ID | JMBV01034310 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 324 |
End posion on genome | 248 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
cgaagagggg |
tRNA gene sequence |
GGGCGCATAGCTCAGCTGGCTAGAGCGCAGTCCTGATAAGACTGAGGTCCCAAGTTCGAT |
Downstream region at tRNA end position |
gaatggatgc |
Secondary structure (Cloverleaf model) | >WENV170644082 Ile GAT g ACCA gaatggatgc G - C G - C G - C C - G G - C C - G A - T T T T G G T T C A C G A A | | | | | G T C T C G C C A A G C G | | | | T T G G A G C C T A G AGGTC C - G A - T G - C T - A C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |