Sequence ID | >WENV170644083 |
Genome ID | JMBV01034366 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 235 |
End posion on genome | 311 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
aattgttcat |
tRNA gene sequence |
GGGCGATTGGTTCAGTTGGTTAGAGCGCCACGTTGACATCGTGGAGATCGTTGGTTCGAG |
Downstream region at tRNA end position |
tataaagaga |
Secondary structure (Cloverleaf model) | >WENV170644083 Val GAC t ACCA tataaagaga G - C G - C G - C C - G G - C A - T T - A T G T T A A C C A T G A G + | | | | G T C T T G G T T G G C G | | + | T T G G A G C T T A G AGATC C - G C - G A - T C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |