Sequence ID | >WENV170644085 |
Genome ID | JMBV01034644 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 345 |
End posion on genome | 269 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
nnttgttcgg |
tRNA gene sequence |
GGGGGCGTAGCTCAGTTTGGTAGAGCGCATGGTTTGGGACCATGATGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
ccattcgttg |
Secondary structure (Cloverleaf model) | >WENV170644085 Pro TGG g CCGA ccattcgttg G - C G - C G - C G - C G - C C - G G - C T A T T G T C C A T G A A + | | | | A T C T C G G C A G G C T | | | | T T G G A G C G T A G ATGTC C - G A - T T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |