Sequence ID | >WENV170644087 |
Genome ID | JMBV01035019 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 110 |
End posion on genome | 189 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
atgagatggg |
tRNA gene sequence |
GGGGCTTTGGCGCAGTTGGGAGCGCACCACACTGGCAGTGTGGGGGGGTCAGGGGGGTTC |
Downstream region at tRNA end position |
aatataagct |
Secondary structure (Cloverleaf model) | >WENV170644087 Ala GGC g ACCA aatataagct G - C G - C G + T G - C C - G T - A T - A T G T T C C C C A T G A G + | | | | A T C G C G G G G G G C G | | | | T T G G C G C G A A GGGGGTCAG C - G C - G A - T C - G A - T C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |