Sequence ID | >WENV170644089 |
Genome ID | JMBV01035760 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 100 |
End posion on genome | 178 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
cccgctccat |
tRNA gene sequence |
GCGCCTGTAGCTCAGGGGGGGATAGAGCACCTGCCTTCTAAGCAGGGAGTCGCAGGTTCG |
Downstream region at tRNA end position |
gattgaaact |
Secondary structure (Cloverleaf model) | >WENV170644089 Arg TCT t GCCA gattgaaact G - C C - G G - C C - G C - G T - A G - C T T T C G T C C A G G G A A | | | | | G G C T C G G C A G G C G | | | | T T G G A G C G A T A A GAGTC C - G C - G T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |