Sequence ID | >WENV170644091 |
Genome ID | JMBV01036096 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 6 |
End posion on genome | 84 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
nnnnnccctt |
tRNA gene sequence |
GGATGCTTATAGCTCAGTTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGTGGTTCG |
Downstream region at tRNA end position |
tctatctaca |
Secondary structure (Cloverleaf model) | >WENV170644091 Ile GAT t ACCA tctatctaca G - C G - C A C T + G G A C A T T T A T C C A C C A G A C T A | | | | | G T C G A T G G T G G C T | T T G G A G C G T T A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |