Sequence ID | >WENV170644092 |
Genome ID | JMBV01036398 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 312 |
End posion on genome | 221 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cactgaatgG |
tRNA gene sequence |
GAGGGGGTGTCCGAGCGGTTTATGGAGCCGGTCTTGAAAACCGGTGTCTCAGAGATGGGC |
Downstream region at tRNA end position |
ttgctcgtag |
Secondary structure (Cloverleaf model) | >WENV170644092 Ser TGA G GCCA ttgctcgtag G - C A C G + T G - C G - C G - C G - C C C T C C C A C T C G A G | | | | A G G C C T G G G T T A G + | | | C G T T G G A T T A G TGTCTCAGAGATGGGCCGT C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |