Sequence ID | >WENV170644093 |
Genome ID | JMBV01036432 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 185 |
End posion on genome | 110 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
attggcgggg |
tRNA gene sequence |
GGGCCCATAGCTCAGCTGGAAGAGCAGCCGGCTCATAACCGGTCGGTCCCAGGTTCGAGC |
Downstream region at tRNA end position |
ttttatttaa |
Secondary structure (Cloverleaf model) | >WENV170644093 Met CAT g ACCA ttttatttaa G - C G - C G - C C - G C - G C - G A - T C G T G G T C C A C G A A | | | | | G T C T C G C C A G G C G | | | | T T G G A G C A A A CGGTC G + T C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |