Sequence ID | >WENV170644094 |
Genome ID | JMBV01036630 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 241 |
End posion on genome | 165 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ctctatcttT |
tRNA gene sequence |
GGGCTCGTAGATCAGGGGGGGTAGATCGTTTCGTTCGCAACGAAAAGGCCGCGGGTTCAA |
Downstream region at tRNA end position |
tctgtttctc |
Secondary structure (Cloverleaf model) | >WENV170644094 Ala CGC T ATgt tctgtttctc G - C G - C G + T C - G T - A C - G G - C T A T C G C C C A G G G A A | | | | | A G C T A G G C G G G C G | | | | T T G G A T C G T A G AGGCC T - A T - A T - A C - G G - C T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |