Sequence ID | >WENV170644095 |
Genome ID | JMBV01037181 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 115 |
End posion on genome | 187 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cgtccgagat |
tRNA gene sequence |
GGGCGCGTAGCTCAATGGTAGAGCAGCGGCCTTTTAAGCCGTTGGTTCAGAGTTCGATCC |
Downstream region at tRNA end position |
ttttatttaa |
Secondary structure (Cloverleaf model) | >WENV170644095 Lys TTT t ACtc ttttatttaa G - C G + T G - C C - G G - C C - G G - C C T T G T C T C A A A A | | | | | G T C T C G C A G A G C G | | | | T T G G A G C T A A TGGTT G + T C - G G - C G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |