Sequence ID | >WENV170644097 |
Genome ID | JMBV01037520 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 129 |
End posion on genome | 218 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tgaaatagtg |
tRNA gene sequence |
GGAGAGGTGACAGAGTGGCCGAATGTGGCGGTCTCGAAAACCGTTGGGCGTGTAAGCGTC |
Downstream region at tRNA end position |
gattcttctt |
Secondary structure (Cloverleaf model) | >WENV170644097 Ser CGA g GCCA gattcttctt G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A T G A G | | | | | A G G A C A G T G G G C G | | | T T C A T G T C G A G TGGGCGTGTAAGCGTCCC G + T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |