Sequence ID | >WENV170644099 |
Genome ID | JMBV01038602 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 269 |
End posion on genome | 193 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cataagttaa |
tRNA gene sequence |
GCCCGAGTAGCTCAGTTGGTCAGAGCAGCTGTTTTGTAAACAGCAGGTCGAGAGTTCGAA |
Downstream region at tRNA end position |
tgcaggaatg |
Secondary structure (Cloverleaf model) | >WENV170644099 Thr TGT a TCCA tgcaggaatg G - C C - G C - G C T G - C A - T G - C T A T C T C T C A T G A A | | | | | G T C T C G G A G A G C G | | | | T T G G A G C T C A A AGGTC G - C C - G T - A G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |