Sequence ID | >WENV170644100 |
Genome ID | JMBV01038602 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 192 |
End posion on genome | 110 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ctggctccaT |
tRNA gene sequence |
GCAGGAATGGCGGAGTGGTCAATCGCGGCAGACTGTAAATCTGCTCCTTCGGGTTCATTG |
Downstream region at tRNA end position |
ttattttatc |
Secondary structure (Cloverleaf model) | >WENV170644100 Tyr GTA T ATat ttattttatc G - C C - G A - T G - C G - C A - T A - T T A T T A A C C A T G A G | | | | | A G G G C G A T T G G C G + | | | T T T T C G C C A A G TCCTTCGGGTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |