Sequence ID | >WENV170644106 |
Genome ID | JMBV01039206 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 235 |
End posion on genome | 142 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tatagcttgc |
tRNA gene sequence |
GGAGAGATGGCTGAGCTGGTCGAAAGCGCTCGCCTCGAAAGCGAGTAGGCGGGGGGGAAC |
Downstream region at tRNA end position |
tttttgtcta |
Secondary structure (Cloverleaf model) | >WENV170644106 Ser CGA c GCCA tttttgtcta G - C G - C A - T G - C A - T G - C A - T T A T C A C C C A T C G A G | | | | | G G G T C G G T G G G C G | | | T T T A A G C C G A G TAGGCGGGGGGGAACCGCCTC C - G T - A C - G G - C C - G C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |