Sequence ID | >WENV170644112 |
Genome ID | JMBV01040550 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 25 |
End posion on genome | 101 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
cttccataat |
tRNA gene sequence |
GAGGGATTAGTTTAATGGTAAAACAACGGTCTCCAAAACCGTATTTAGGGGGGGTTCGAA |
Downstream region at tRNA end position |
aatgttctct |
Secondary structure (Cloverleaf model) | >WENV170644112 Trp CCA t GCCA aatgttctct G + T A - T G - C G - C G + T A - T T - A T A T T C T C C A A A A + | + | | G T T T T G G G G G G C G | | | | T T G A A A C T A A ATTTAGG A - T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |