Sequence ID | >WENV170644113 |
Genome ID | JMBV01040550 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 105 |
End posion on genome | 190 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cttgccaaat |
tRNA gene sequence |
GTTCTCTTGGTGGAAATGGTAGACACGACAGAATGAGAGTCTGTTACTCGTAGAGTGTGC |
Downstream region at tRNA end position |
attaaattgg |
Secondary structure (Cloverleaf model) | >WENV170644113 Leu GAG t ACCA attaaattgg G - C T - A T - A C - G T + G C - G T - A T A T C G T T C A A A A G | | | | | A T G G T G G C A A G C G | | | T T G A C A C T A G G TACTCGTAGAGTGT A - T C - G A - T G - C A - T A G T A G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |