Sequence ID | >WENV170644134 |
Genome ID | JMBV01044533 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 254 |
End posion on genome | 179 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
caaccagtat |
tRNA gene sequence |
GCTGGCGTAGCTCAGTCGGCAGAGCGTATCCTTGGTAAGGATAAGGTCACCGGTTCAATC |
Downstream region at tRNA end position |
ttaagttttg |
Secondary structure (Cloverleaf model) | >WENV170644134 Thr GGT t TCCA ttaagttttg G - C C - G T - A G - C G + T C - G G - C C T T T G G C C A T G A A | | | | | A C C T C G A C C G G C G | | | | T T G G A G C C A G AGGTC T - A A - T T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |