Sequence ID | >WENV170644136 |
Genome ID | JMBV01045010 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 56 |
End posion on genome | 132 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atttgcatat |
tRNA gene sequence |
GGCGGCGTAGCTCAGGTGGTCAGAGCATGCGGTTCATACCCGCAGTGTCACTGGTTCGAG |
Downstream region at tRNA end position |
tagaaattac |
Secondary structure (Cloverleaf model) | >WENV170644136 Met CAT t ACCA tagaaattac G + T G - C C - G G - C G - C C - G G - C T G T T G A C C A G G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C T C A A GTGTC T - A G - C C - G G - C G - C T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |