Sequence ID | >WENV170644140 |
Genome ID | JMBV01045397 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 41 |
End posion on genome | 117 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
catgaagcgg |
tRNA gene sequence |
GCGCCCGTAGCTCAGTTGGACAGAGCGATGGACTTCGAATCCATAGGCCGCAGGTTCGAG |
Downstream region at tRNA end position |
tttttgtttg |
Secondary structure (Cloverleaf model) | >WENV170644140 Arg TCG g GCCA tttttgtttg G - C C - G G - C C - G C - G C - G G - C C G T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A C A G AGGCC A - T T - A G - C G - C A - T C A T A T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |