Sequence ID | >WENV170644142 |
Genome ID | JMBV01046388 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 170 |
End posion on genome | 96 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tttatggaat |
tRNA gene sequence |
GCTGGCGTGGCTCAACGGTAGAGCAGCTGATTTGTAATCAGCAGGTTGGGGGTTCGATTC |
Downstream region at tRNA end position |
tttgtgaccc |
Secondary structure (Cloverleaf model) | >WENV170644142 Thr TGT t TCCA tttgtgaccc G - C C - G T - A G - C G - C C - G G - C T T T T T C C C A A A G + + | | | G C C T C G G G G G G C G | | | | T T G G A G C T A A AGGTT G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |