Sequence ID | >WENV170644144 |
Genome ID | JMBV01046467 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 159 |
End posion on genome | 83 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
taatttacga |
tRNA gene sequence |
GCGCCTGTAGCTCAGTCGGATAGAGCAACGGACTTCTAATCCGTAGGCCAGAGGTTCGAA |
Downstream region at tRNA end position |
ttcatagaat |
Secondary structure (Cloverleaf model) | >WENV170644144 Arg TCT a ACCA ttcatagaat G + T C - G G - C C - G C - G T - A G - C T A T T C T C C A T G A A | | | | | G C C T C G A G A G G C G | | | | T T G G A G C A T A A AGGCC A - T C - G G - C G - C A - T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |